findgRNAs {CRISPRseek}R Documentation

Find potential gRNAs

Description

Find potential gRNAs for an input file containing sequences in fasta format

Usage

findgRNAs(inputFilePath,  baseEditing = FALSE, targetBase = "C", editingWindow = 4:8,
    format = "fasta", PAM = "NGG", PAM.size = 3, 
    findPairedgRNAOnly = FALSE, annotatePaired = TRUE,
    paired.orientation = c("PAMout", "PAMin"), enable.multicore = FALSE,
    n.cores.max = 6, gRNA.pattern = "", gRNA.size = 20, 
    overlap.gRNA.positions = c(17,18),
    primeEditing = FALSE,
        PBS.length = 13L,
        RT.template.length = 8:28,
        RT.template.pattern = "D$",
        corrected.seq,
        targeted.seq.length.change,
        bp.after.target.end = 15L,
        target.start,
        target.end,
        primeEditingPaired.output = "pairedgRNAsForPE.xls", 
    min.gap = 0, max.gap = 20,
    pairOutputFile, name.prefix = "", 
    featureWeightMatrixFile = system.file("extdata", 
        "DoenchNBT2014.csv", package = "CRISPRseek"), baseBeforegRNA = 4, 
        baseAfterPAM = 3, calculategRNAEfficacy = FALSE, efficacyFile,
    PAM.location = "3prime", 
    rule.set = c("Root_RuleSet1_2014", "Root_RuleSet2_2016", "CRISPRscan"))

Arguments

inputFilePath

Sequence input file path or a DNAStringSet object that contains sequences to be searched for potential gRNAs

baseEditing

Indicate whether to design gRNAs for base editing. Default to FALSE If TRUE, please set baseEditing = TRUE, targetBase and editingWidow accordingly.

targetBase

Applicable only when baseEditing is set to TRUE. It is used to indicate the target base for base editing systems, default to C for converting C to T in the CBE system. Please change it to A if you intend to use the ABE system.

editingWindow

Applicable only when baseEditing is set to TRUE. It is used to indicate the effective editing window, default to 4 to 8 which is for the original CBE system. Please change it accordingly if the system you use have a different editing window.

format

Format of the input file, fasta and fastq are supported, default fasta

PAM

protospacer-adjacent motif (PAM) sequence after the gRNA, default NGG

PAM.size

PAM length, default 3

findPairedgRNAOnly

Choose whether to only search for paired gRNAs in such an orientation that the first one is on minus strand called reverse gRNA and the second one is on plus strand called forward gRNA. TRUE or FALSE, default FALSE

annotatePaired

Indicate whether to output paired information, default TRUE

paired.orientation

PAMin orientation means the two adjacent PAMs on the sense and antisense strands face inwards towards each other like N21GG and CCN21 whereas PAMout orientation means they face away from each other like CCN21 and N21GG

enable.multicore

Indicate whether enable parallel processing, default FALSE. For super long sequences with lots of gRNAs, suggest set it to TRUE

n.cores.max

Indicating maximum number of cores to use in multi core mode, i.e., parallel processing, default 6. Please set it to 1 to disable multicore processing for small dataset.

gRNA.pattern

Regular expression or IUPAC Extended Genetic Alphabet to represent gRNA pattern, default is no restriction. To specify that the gRNA must start with GG for example, then set it to ^GG. Please see help(translatePattern) for a list of IUPAC Extended Genetic Alphabet.

gRNA.size

The size of the gRNA, default 20

overlap.gRNA.positions

The required overlap positions of gRNA and restriction enzyme cut site, default 17 and 18

primeEditing

Indicate whether to design gRNAs for prime editing. Default to FALSE. If true, please set PBS.length, RT.template.length, RT.template.pattern, targeted.seq.length.change, bp.after.target.end, target.start, and target.end accordingly

PBS.length

Applicable only when primeEditing is set to TRUE. It is used to specify the number of bases to ouput for primer binding site.

RT.template.length

Applicable only when primeEditing is set to TRUE. It is used to specify the number of bases required for RT template, default to 8 to 18. Please increase the length if the edit is large insertion. Only gRNAs with calculated RT.template.length falling into the specified range will be in the output. It is calculated as the following. RT.template.length = target.start – cut.start + (target.end - target.start) + targeted.seq.length.change + bp.after.target.end

RT.template.pattern

Applicable only when primeEditing is set to TRUE. It is used to specify the RT template sequence pattern, default to not ending with C according to https://doi.org/10.1038/s41586-019-1711-4

corrected.seq

Applicable only when primeEditing is set to TRUE. It is used to specify the mutated or inserted sequences after successful editing.

targeted.seq.length.change

Applicable only when primeEditing is set to TRUE. It is used to specify the number of targeted sequence length change. Please set it to 0 for base changes, positive numbers for insersion, and negative number for deletion. For example, 10 means that the corrected sequence will have 10bp insertion, -10 means that the corrected sequence will have 10bp deletion, and 0 means only bases have been changed and the sequence length remains the same

bp.after.target.end

Applicable only when primeEditing is set to TRUE. It is used to specify the number of bases to add after the target change end site as part of RT template. Please refer to RT.template.length for how this parameter influences the RT.template.length calculation which is used as a filtering criteria in pregRNA selection.

target.start

Applicable only when primeEditing is set to TRUE. It is used to specify the start location in the input sequence to make changes, which will be used to obtain the RT template sequence. Please also refer to RT.template.length for how this parameter influences the RT.template.length calculation which is used as a filtering criteria in pregRNA selection.

target.end

Applicable only when primeEditing is set to TRUE. It is used to specify the end location in the input sequnence to make changes, which will be used to obtain the RT template sequence. Please also refer to RT.template.length for how this parameter influences the RT.template.length calculation which is used as a filtering criteria in pregRNA selection.

primeEditingPaired.output

Applicable only when primeEditing is set to TRUE. It is used to specify the file path to save pegRNA and the second gRNA with PBS, RT.template, gRNA sequences, default pairedgRNAsForPE.xls

min.gap

Minimum distance between two oppositely oriented gRNAs to be valid paired gRNAs. Default 0

max.gap

Maximum distance between two oppositely oriented gRNAs to be valid paired gRNAs. Default 20

pairOutputFile

The output file for writing paired gRNA information to

name.prefix

The prefix used when assign name to found gRNAs, default gRNA, short for guided RNA.

baseBeforegRNA

Number of bases before gRNA used for calculating gRNA efficiency, default 4 for spCas9 Please note, for PAM located on the 5 prime, need to specify the number of bases before the PAM sequence plus PAM size.

baseAfterPAM

Number of bases after PAM used for calculating gRNA efficiency, default 3 for spCas9 Please note, for PAM located on the 5 prime, need to include the length of the gRNA plus the extended sequence on the 3 prime

featureWeightMatrixFile

Feature weight matrix file used for calculating gRNA efficiency. By default DoenchNBT2014 weight matrix is used. To use alternative weight matrix file, please input a csv file with first column containing significant features and the second column containing the corresponding weights for the features. Please see Doench et al., 2014 for details.

calculategRNAEfficacy

Default to FALSE, not to calculate gRNA efficacy

efficacyFile

File path to write gRNA efficacies

PAM.location

PAM location relative to gRNA. For example, spCas9 PAM is located on the 3 prime while cpf1 PAM is located on the 5 prime

rule.set

Specify a rule set scoring system for calculating gRNA efficacy.

Details

If users already has a fasta file that contains a set of potential gRNAs, then users can call filergRNAs directly although the easiest way is to call the one-stop-shopping function OffTargetAnalysis with findgRNAs set to FALSE.

Value

DNAStringSet consists of potential gRNAs that can be input to filtergRNAs function directly

Note

If the input sequence file contains multiple >300 bp sequences, suggest create one input file for each sequence and run the OffTargetAnalysis separately.

Author(s)

Lihua Julie Zhu

See Also

offTargetAnalysis

Examples

    findgRNAs(inputFilePath = system.file("extdata",
        "inputseq.fa", package = "CRISPRseek"),
        pairOutputFile = "testpairedgRNAs.xls",
        findPairedgRNAOnly = TRUE)               


    ##### predict gRNA efficacy using CRISPRscan
    featureWeightMatrixFile <- system.file("extdata", "Morenos-Mateo.csv",
            package = "CRISPRseek")

    findgRNAs(inputFilePath = system.file("extdata",
        "inputseq.fa", package = "CRISPRseek"),
        pairOutputFile = "testpairedgRNAs.xls",
        findPairedgRNAOnly = FALSE,
        calculategRNAEfficacy= TRUE,
        rule.set = "CRISPRscan", 
        baseBeforegRNA = 6, baseAfterPAM = 6,
        featureWeightMatrixFile = featureWeightMatrixFile,
        efficacyFile = "testCRISPRscanEfficacy.xls"
     )

     findgRNAs(inputFilePath = system.file("extdata",
        "testCRISPRscan.fa", package = "CRISPRseek"),
        pairOutputFile = "testpairedgRNAs.xls",
        findPairedgRNAOnly = FALSE,
        calculategRNAEfficacy= TRUE,
        rule.set = "CRISPRscan",
        baseBeforegRNA = 6, baseAfterPAM = 6,
        featureWeightMatrixFile = featureWeightMatrixFile,
        efficacyFile = "testCRISPRscanEfficacy.xls"
     )

    findgRNAs(inputFilePath = system.file("extdata", 
        "cpf1.fa", package = "CRISPRseek"), 
        findPairedgRNAOnly=FALSE, 
        pairOutputFile = "testpairedgRNAs-cpf1.xls", 
        PAM="TTTN", PAM.location = "5prime", PAM.size = 4, 
        overlap.gRNA.positions = c(19,23),
        baseBeforegRNA = 8, baseAfterPAM = 23,
        calculategRNAEfficacy= TRUE, 
        featureWeightMatrixFile = system.file("extdata", 
            "DoenchNBT2014.csv", package = "CRISPRseek"),
       efficacyFile = "testcpf1Efficacy.xls")

    findgRNAs(inputFilePath = system.file("extdata", 
             "cpf1.fa", package = "CRISPRseek"), 
             findPairedgRNAOnly=FALSE, 
             pairOutputFile = "testpairedgRNAs-cpf1.xls", 
             PAM="TTTN", PAM.location = "5prime", PAM.size = 4, 
             overlap.gRNA.positions = c(19,23),
             baseBeforegRNA = 8, baseAfterPAM = 23,
             calculategRNAEfficacy= TRUE, 
             featureWeightMatrixFile = system.file("extdata", 
                 "DoenchNBT2014.csv", package = "CRISPRseek"),
            efficacyFile = "testcpf1Efficacy.xls", baseEditing =  TRUE, 
            editingWindow=20, targetBase = "X")

    findgRNAs(inputFilePath = system.file("extdata", 
             "cpf1.fa", package = "CRISPRseek"), 
             findPairedgRNAOnly=FALSE, 
             pairOutputFile = "testpairedgRNAs-cpf1.xls", 
             PAM="TTTN", PAM.location = "5prime", PAM.size = 4, 
             overlap.gRNA.positions = c(19,23),
             baseBeforegRNA = 8, baseAfterPAM = 23,
             calculategRNAEfficacy= TRUE, 
             featureWeightMatrixFile = system.file("extdata", 
                 "DoenchNBT2014.csv", package = "CRISPRseek"),
            efficacyFile = "testcpf1Efficacy.xls", baseEditing =  TRUE,
            editingWindow=20, targetBase = "C")

     inputSeq <-  DNAStringSet(paste(
"CCAGTTTGTGGATCCTGCTCTGGTGTCCTCCACACCAGAATCAGGGATCGAAAACTCA",
"TCAGTCGATGCGAGTCATCTAAATTCCGATCAATTTCACACTTTAAACG", sep =""))
     gRNAs <-  findgRNAs(inputFilePath =  inputSeq,
         pairOutputFile = "testpairedgRNAs1.xls",
         PAM.size = 3L,
         gRNA.size = 20L,
         overlap.gRNA.positions = c(17L,18L),
         PBS.length = 15,
         corrected.seq = "T",
         RT.template.pattern = "D$",
         RT.template.length = 8:30, 
         targeted.seq.length.change = 0,
         bp.after.target.end = 15,
         target.start = 46,
         target.end = 46,
         paired.orientation = "PAMin", min.gap = 20, max.gap = 90, 
         primeEditing = TRUE, findPairedgRNAOnly = TRUE)
 

[Package CRISPRseek version 1.27.5 Index]